Schema for Simple Repeats - Simple Tandem Repeats by TRF

JavaScript is disabled in your web browser

You must have JavaScript enabled in your web browser to use the Genome Browser

Schema for Simple Repeats - Simple Tandem Repeats by TRF

Database: DeugGB2 Primary Table: simpleRepeat Row Count: 39,501

field	example	SQL type	info
`bin`	585	`smallint(5) unsigned`	range
`chrom`	AFPQ02000004	`varchar(255)`	values
`chromStart`	256	`int(10) unsigned`	range
`chromEnd`	290	`int(10) unsigned`	range
`name`	trf	`varchar(255)`	values
`period`	6	`int(10) unsigned`	range
`copyNum`	5.7	`float`	range
`consensusSize`	6	`int(10) unsigned`	range
`perMatch`	96	`int(10) unsigned`	range
`perIndel`	0	`int(10) unsigned`	range
`score`	50	`int(10) unsigned`	range
`A`	41	`int(10) unsigned`	range
`C`	52	`int(10) unsigned`	range
`G`	5	`int(10) unsigned`	range
`T`	0	`int(10) unsigned`	range
`entropy`	1.25	`float`	range
`sequence`	CCCAAA	`longblob`

Sample Rows

bin	chrom	chromStart	chromEnd	name	period	copyNum	consensusSize	perMatch	perIndel	score	A	C	G	T	entropy	sequence
585	AFPQ02000004	256	290	trf	6	5.7	6	96	0	50	41	52	5	0	1.25	CCCAAA
585	AFPQ02000005	3	35	trf	15	2.1	16	94	5	57	28	12	15	43	1.83	ATTTGTACGTACTGTA
585	AFPQ02000007	644	669	trf	13	1.9	13	100	0	50	16	32	0	52	1.44	CTTCTAACTTCTT
585	AFPQ02000014	503	542	trf	8	4.9	8	87	0	60	20	53	12	12	1.71	CTGCACCA
585	AFPQ02000018	0	143	trf	73	1.9	74	95	1	261	27	13	22	35	1.92	AGTTGTAGGACCGTACTGTTGTAACTTGTCTAATAATTCCTTGAAACTTAAGGTAACTTTCATGAGGGATTATC
585	AFPQ02000019	579	622	trf	15	2.8	16	80	20	56	37	37	0	25	1.56	ACAACCATTACCATTT
585	AFPQ02000027	43	78	trf	7	5	7	90	10	54	28	0	0	71	0.86	ATATTTT
585	AFPQ02000027	356	393	trf	16	2.2	18	85	9	51	2	18	2	75	1.04	TTTCCTTATCTTTTTCGT
585	AFPQ02000031	0	269	trf	8	33.5	8	97	2	513	12	12	24	49	1.75	TGTATGTC
585	AFPQ02000031	3253	3319	trf	28	2.4	28	92	0	105	40	27	15	16	1.88	GAAACACTCAGATCAATTGAAGACACCC

Note: all start coordinates in our database are 0-based, not 1-based. See explanation here.

Simple Repeats (simpleRepeat) Track Description


	Description This track displays simple tandem repeats (possibly imperfect repeats) located by Tandem Repeats Finder (TRF) which is specialized for this purpose. These repeats can occur within coding regions of genes and may be quite polymorphic. Repeat expansions are sometimes associated with specific diseases. Methods For more information about the TRF program, see Benson (1999). Credits TRF was written by Gary Benson. References Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999 Jan 15;27(2):573-80. PMID: 9862982; PMC: PMC148217