Schema for Simple Repeats - Simple Tandem Repeats by TRF

Database: DmirGB2 Primary Table: simpleRepeat Row Count: 76,116 Data last updated: 2022-10-20

field	example	SQL type	info
`bin`	585	`smallint(5) unsigned`	range
`chrom`	CM001516	`varchar(255)`	values
`chromStart`	5786	`int(10) unsigned`	range
`chromEnd`	5858	`int(10) unsigned`	range
`name`	GAGCCTTTTGCGATAT	`varchar(255)`	values
`period`	23	`int(10) unsigned`	range
`copyNum`	3.1	`float`	range
`consensusSize`	23	`int(10) unsigned`	range
`perMatch`	95	`int(10) unsigned`	range
`perIndel`	0	`int(10) unsigned`	range
`score`	135	`int(10) unsigned`	range
`A`	20	`int(10) unsigned`	range
`C`	16	`int(10) unsigned`	range
`G`	20	`int(10) unsigned`	range
`T`	41	`int(10) unsigned`	range
`entropy`	1.9	`float`	range
`sequence`	GAGCCTTTTGCGATATCATTTAT	`longblob`

Sample Rows

bin	chrom	chromStart	chromEnd	name	period	copyNum	consensusSize	perMatch	perIndel	score	A	C	G	T	entropy	sequence
585	CM001516	5786	5858	GAGCCTTTTGCGATAT	23	3.1	23	95	0	135	20	16	20	41	1.9	GAGCCTTTTGCGATATCATTTAT
585	CM001516	5913	5960	TATCAAAAAAGACTCA	23	2	23	83	0	58	48	17	12	21	1.79	TATCAAAAAAGACTCACAAATGA
585	CM001516	7710	7773	CGAGCCTTTTGCGATA	23	2.7	23	82	0	81	15	20	23	39	1.91	CGAGCCTTTTGCGATATCATGTA
585	CM001516	7856	7910	CAAACGATATCGCAAA	23	2.3	23	93	0	99	40	24	20	14	1.9	CAAACGATATCGCAAAAGGCTCG
585	CM001516	10999	11039	GGAC	4	10	4	88	0	62	30	25	45	0	1.54	GGAC
585	CM001516	10999	11047	GGACGGACAGAC	12	4	12	91	0	78	33	25	41	0	1.55	GGACGGACAGAC
585	CM001516	11000	11048	GACGGACA	8	6	8	92	0	69	35	25	39	0	1.56	GACGGACA
585	CM001516	11209	11273	ATCGCAAAAGGCTCGC	23	2.8	23	80	0	83	40	25	20	14	1.89	ATCGCAAAAGGCTCGCAAACGAA
585	CM001516	12039	12068	ATCTGTCGACACGTC	15	1.9	15	100	0	58	20	31	20	27	1.98	ATCTGTCGACACGTC
585	CM001516	22880	22932	GCTTCAGCCTCTCCTC	25	2.1	24	86	10	70	15	46	9	28	1.77	GCTTCAGCCTCTCCTCCATCTCCA

Note: all start coordinates in our database are 0-based, not 1-based. See explanation here.

Simple Repeats (simpleRepeat) Track Description


	Description This track displays simple tandem repeats (possibly imperfect repeats) located by Tandem Repeats Finder (TRF) which is specialized for this purpose. These repeats can occur within coding regions of genes and may be quite polymorphic. Repeat expansions are sometimes associated with specific diseases. Methods For more information about the TRF program, see Benson (1999). Credits TRF was written by Gary Benson. References Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999 Jan 15;27(2):573-80. PMID: 9862982; PMC: PMC148217

Description