Schema for Simple Repeats - Simple Tandem Repeats by TRF

JavaScript is disabled in your web browser

You must have JavaScript enabled in your web browser to use the Genome Browser

Schema for Simple Repeats - Simple Tandem Repeats by TRF

Database: DmojImproved Primary Table: simpleRepeat Row Count: 172,655

field	example	SQL type	info
`bin`	585	`smallint(5) unsigned`	range
`chrom`	improved_6498	`varchar(255)`	values
`chromStart`	521	`int(10) unsigned`	range
`chromEnd`	636	`int(10) unsigned`	range
`name`	trf	`varchar(255)`	values
`period`	61	`int(10) unsigned`	range
`copyNum`	1.9	`float`	range
`consensusSize`	61	`int(10) unsigned`	range
`perMatch`	81	`int(10) unsigned`	range
`perIndel`	3	`int(10) unsigned`	range
`score`	142	`int(10) unsigned`	range
`A`	40	`int(10) unsigned`	range
`C`	26	`int(10) unsigned`	range
`G`	17	`int(10) unsigned`	range
`T`	15	`int(10) unsigned`	range
`entropy`	1.9	`float`	range
`sequence`	AACAAGAAAGAAAACTCTAGCCGAGAC...	`longblob`

Sample Rows

bin	chrom	chromStart	chromEnd	name	period	copyNum	consensusSize	perMatch	perIndel	score	A	C	G	T	entropy	sequence
585	improved_6498	521	636	trf	61	1.9	61	81	3	142	40	26	17	15	1.9	AACAAGAAAGAAAACTCTAGCCGAGACTAATCGACTACGAGATACCCTGAACCCAACAAAT
585	improved_6498	724	769	trf	18	2.5	18	81	0	54	46	35	6	11	1.66	CACACACAGACATACACA
585	improved_6498	734	762	trf	14	2	14	100	0	56	50	35	0	14	1.43	CATACATACACACA
585	improved_6498	4545	4600	trf	14	3.9	14	90	0	74	49	40	0	10	1.38	CATACACACACACA
585	improved_6498	4552	4600	trf	2	24	2	82	0	60	50	41	0	8	1.33	AC
585	improved_6498	10075	10190	trf	61	1.9	61	83	3	151	39	26	17	16	1.91	AACAAGTAAGAAAACTCTAGCCGAGACTAATCGACTACGAGATACCCTGAACCCAACAAAT
585	improved_6498	10278	10323	trf	18	2.5	18	81	0	54	46	35	6	11	1.66	CACACACAGACATACACA
585	improved_6498	10288	10316	trf	14	2	14	100	0	56	50	35	0	14	1.43	CATACATACACACA
585	improved_6498	14995	15055	trf	22	2.7	22	81	0	75	40	43	13	3	1.6	CACGCACACACACACACACAGG
585	improved_6498	15029	15074	trf	18	2.5	18	81	0	54	46	35	6	11	1.66	CACACACAGACATACACA

Note: all start coordinates in our database are 0-based, not 1-based. See explanation here.

Simple Repeats (simpleRepeat) Track Description


	Description This track displays simple tandem repeats (possibly imperfect repeats) located by Tandem Repeats Finder (TRF) which is specialized for this purpose. These repeats can occur within coding regions of genes and may be quite polymorphic. Repeat expansions are sometimes associated with specific diseases. Methods For more information about the TRF program, see Benson (1999). Credits TRF was written by Gary Benson. References Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999 Jan 15;27(2):573-80.