Schema for Simple Repeats - Simple Tandem Repeats by TRF

JavaScript is disabled in your web browser

You must have JavaScript enabled in your web browser to use the Genome Browser

Schema for Simple Repeats - Simple Tandem Repeats by TRF

Database: DrhoGB2 Primary Table: simpleRepeat Row Count: 61,370

field	example	SQL type	info
`bin`	585	`smallint(5) unsigned`	range
`chrom`	AFPP02000003	`varchar(255)`	values
`chromStart`	463	`int(10) unsigned`	range
`chromEnd`	493	`int(10) unsigned`	range
`name`	trf	`varchar(255)`	values
`period`	15	`int(10) unsigned`	range
`copyNum`	2	`float`	range
`consensusSize`	15	`int(10) unsigned`	range
`perMatch`	100	`int(10) unsigned`	range
`perIndel`	0	`int(10) unsigned`	range
`score`	60	`int(10) unsigned`	range
`A`	13	`int(10) unsigned`	range
`C`	46	`int(10) unsigned`	range
`G`	13	`int(10) unsigned`	range
`T`	26	`int(10) unsigned`	range
`entropy`	1.8	`float`	range
`sequence`	CCCGCCGCATATCTT	`longblob`

Sample Rows

bin	chrom	chromStart	chromEnd	name	period	copyNum	consensusSize	perMatch	perIndel	score	A	C	G	T	entropy	sequence
585	AFPP02000003	463	493	trf	15	2	15	100	0	60	13	46	13	26	1.8	CCCGCCGCATATCTT
585	AFPP02000003	15368	15421	trf	21	2.5	21	77	17	56	11	43	32	13	1.79	GCTGCTGCTCCCGCCCCAGAA
585	AFPP02000003	15380	15424	trf	21	2.1	21	87	8	63	13	40	34	11	1.81	GCCCCAGAAGCTGGCGCTCCG
585	AFPP02000006	273	298	trf	13	1.9	13	100	0	50	32	0	8	60	1.26	TTTTAAAATTGTT
585	AFPP02000017	710	758	trf	16	3.1	16	84	3	71	37	54	8	0	1.31	ACCACCCAACCACCGA
585	AFPP02000017	2080	2118	trf	20	1.9	20	94	5	69	63	5	15	15	1.48	AAACAAAATGAAATATAGGA
585	AFPP02000033	581	624	trf	20	2.1	20	91	0	68	51	4	2	41	1.35	AATCTAAATAAATTAATTAT
585	AFPP02000039	1801	1840	trf	14	2.8	14	84	0	51	15	30	20	33	1.94	CAGTTCCCAGTTCG
585	AFPP02000044	1274	1313	trf	11	3.5	11	85	3	51	51	5	0	43	1.24	TATTACTAAAA
585	AFPP02000044	1315	1344	trf	15	1.9	15	100	0	58	41	6	17	34	1.76	ATATATGGTAACATG

Note: all start coordinates in our database are 0-based, not 1-based. See explanation here.

Simple Repeats (simpleRepeat) Track Description


	Description This track displays simple tandem repeats (possibly imperfect repeats) located by Tandem Repeats Finder (TRF) which is specialized for this purpose. These repeats can occur within coding regions of genes and may be quite polymorphic. Repeat expansions are sometimes associated with specific diseases. Methods For more information about the TRF program, see Benson (1999). Credits TRF was written by Gary Benson. References Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999 Jan 15;27(2):573-80. PMID: 9862982; PMC: PMC148217