Schema for Simple Repeats - Simple Tandem Repeats by TRF

JavaScript is disabled in your web browser

You must have JavaScript enabled in your web browser to use the Genome Browser

Schema for Simple Repeats - Simple Tandem Repeats by TRF

Database: DtakGB2 Primary Table: simpleRepeat Row Count: 57,948

field	example	SQL type	info
`bin`	585	`smallint(5) unsigned`	range
`chrom`	AFFI02000001	`varchar(255)`	values
`chromStart`	5878	`int(10) unsigned`	range
`chromEnd`	5952	`int(10) unsigned`	range
`name`	trf	`varchar(255)`	values
`period`	32	`int(10) unsigned`	range
`copyNum`	2.3	`float`	range
`consensusSize`	33	`int(10) unsigned`	range
`perMatch`	92	`int(10) unsigned`	range
`perIndel`	2	`int(10) unsigned`	range
`score`	123	`int(10) unsigned`	range
`A`	39	`int(10) unsigned`	range
`C`	0	`int(10) unsigned`	range
`G`	17	`int(10) unsigned`	range
`T`	43	`int(10) unsigned`	range
`entropy`	1.49	`float`	range
`sequence`	TGAATGAATTAGAATTTTTGAGTTTAA...	`longblob`

Sample Rows

bin	chrom	chromStart	chromEnd	name	period	copyNum	consensusSize	perMatch	perIndel	score	A	C	G	T	entropy	sequence
585	AFFI02000001	5878	5952	trf	32	2.3	33	92	2	123	39	0	17	43	1.49	TGAATGAATTAGAATTTTTGAGTTTAATAGAAT
585	AFFI02000001	7312	7467	trf	50	3.1	50	89	2	215	34	24	20	20	1.96	AAAGCAATCCAAAAGATGCGATCCAGAACGCATCTTTTGGAATGCATCCA
585	AFFI02000001	7325	7452	trf	25	5.1	24	65	16	80	33	23	21	22	1.98	GGATGCATCCAGAACGCATCTTTT
585	AFFI02000001	7326	7467	trf	49	2.8	50	91	3	223	34	24	20	21	1.97	GATGCGATCCAGAACGCATCTTTTGGAATGCATCCAGAAGCAATCCAAAA
585	AFFI02000001	7454	7480	trf	10	2.6	10	100	0	52	34	23	19	23	1.96	GCATTCAGAA
585	AFFI02000001	7578	7608	trf	11	2.7	11	100	0	60	16	33	40	10	1.82	GGAGCGCTCCA
585	AFFI02000001	8200	8231	trf	8	3.9	8	100	0	62	51	25	12	9	1.7	GACAAACT
585	AFFI02000001	9016	9041	trf	11	2.3	11	100	0	50	60	0	16	24	1.36	AAATGTTAGAA
585	AFFI02000001	14417	14463	trf	20	2.3	20	85	7	58	36	6	19	36	1.78	TAGAAATTTTTACTGAAGAT
585	AFFI02000001	17172	17211	trf	4	9.8	4	82	0	51	43	25	30	0	1.55	ACAG

Note: all start coordinates in our database are 0-based, not 1-based. See explanation here.

Simple Repeats (simpleRepeat) Track Description


	Description This track displays simple tandem repeats (possibly imperfect repeats) located by Tandem Repeats Finder (TRF) which is specialized for this purpose. These repeats can occur within coding regions of genes and may be quite polymorphic. Repeat expansions are sometimes associated with specific diseases. Methods For more information about the TRF program, see Benson (1999). Credits TRF was written by Gary Benson. References Benson G. Tandem repeats finder: a program to analyze DNA sequences. Nucleic Acids Res. 1999 Jan 15;27(2):573-80. PMID: 9862982; PMC: PMC148217